Review



micropulser electroporator  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Bio-Rad micropulser electroporator
    Micropulser Electroporator, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1635 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/micropulser+electroporator/MicroPulser+Electroporator/pmc13058971-162-3-5
    Average 96 stars, based on 1635 article reviews
    micropulser electroporator - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Electroporation:

    Article Title: Protocol to identify SINE-VNTR-Alu regulators using genome-wide screening in human K562 cells
    Article Snippet: .. Conduct electroporation in MicroPulser Electroporator (Bio-Rad). i. ..

    Article Title: CRISPR-Cas effector polypeptides and methods of use thereof
    Article Snippet: .. The Casλ vectors and Casλ vectors with a non-targeting guide control plasmid were transformed into 25 μL of electrocompetent cells with 100 ng of plasmid via electroporation in 0.1 mm electroporation cuvettes (Bio-Rad) on a Micropulser electroporator (Bio-Rad), cells were recovered in 1 mL recovery medium (Lucigen) shaking at 37° C. for one hour. ..

    Article Title: Electrode Reduction by Vibrio natriegens Depends on Balanced Expression of Multiheme Cytochromes
    Article Snippet: For transformation by electroporation, 100 ng of plasmid DNA was mixed with a 50 μL aliquot of electrocompetent V. natriegens cells in a 1 mm gap electroporation cuvette (Bio-Rad, 1652089). .. Electroporation was performed at 0.9 kV using a MicroPulser Electroporator (Bio-Rad). ..

    Control:

    Article Title: CRISPR-Cas effector polypeptides and methods of use thereof
    Article Snippet: .. The Casλ vectors and Casλ vectors with a non-targeting guide control plasmid were transformed into 25 μL of electrocompetent cells with 100 ng of plasmid via electroporation in 0.1 mm electroporation cuvettes (Bio-Rad) on a Micropulser electroporator (Bio-Rad), cells were recovered in 1 mL recovery medium (Lucigen) shaking at 37° C. for one hour. ..

    Plasmid Preparation:

    Article Title: CRISPR-Cas effector polypeptides and methods of use thereof
    Article Snippet: .. The Casλ vectors and Casλ vectors with a non-targeting guide control plasmid were transformed into 25 μL of electrocompetent cells with 100 ng of plasmid via electroporation in 0.1 mm electroporation cuvettes (Bio-Rad) on a Micropulser electroporator (Bio-Rad), cells were recovered in 1 mL recovery medium (Lucigen) shaking at 37° C. for one hour. ..

    Article Title: Methods for evaluating bacterial dispersal on hyphal networks
    Article Snippet: .. Fifty microliter aliquots of the cell suspension were electroporated with five μL of pBBR-RFP plasmid using a MicroPulser electroporator (Bio-Rad). .. Transformants were recovered in nutrient broth (NB) medium without antibiotic for three hours at 28°C and plated on NA plates containing 25 μg/mL gentamicin (Melford, UK).

    Transformation Assay:

    Article Title: CRISPR-Cas effector polypeptides and methods of use thereof
    Article Snippet: .. The Casλ vectors and Casλ vectors with a non-targeting guide control plasmid were transformed into 25 μL of electrocompetent cells with 100 ng of plasmid via electroporation in 0.1 mm electroporation cuvettes (Bio-Rad) on a Micropulser electroporator (Bio-Rad), cells were recovered in 1 mL recovery medium (Lucigen) shaking at 37° C. for one hour. ..

    Article Title: Template Switching as a Driver of Promoter Evolution in Yeast: Case Study of the GRE2 Gene.
    Article Snippet: .. The ligated products were then transformed into NEB10-beta Electrocompetent cells using Biorad’s MicroPulser Electroporator, and transformed cells were spread on LB + 100 μg/ml Ampicillin plates. ..

    Suspension:

    Article Title: Methods for evaluating bacterial dispersal on hyphal networks
    Article Snippet: .. Fifty microliter aliquots of the cell suspension were electroporated with five μL of pBBR-RFP plasmid using a MicroPulser electroporator (Bio-Rad). .. Transformants were recovered in nutrient broth (NB) medium without antibiotic for three hours at 28°C and plated on NA plates containing 25 μg/mL gentamicin (Melford, UK).

    Incubation:

    Article Title: Evolutionary diversification of invertase paralogs couples carbon metabolism and sexual reproduction in fission yeasts
    Article Snippet: .. After incubation on ice for 5 mins, the mixture was electroporated using a MicroPulser electroporator (2 mm cuvette, 3.0 kV, Bio-Rad), and then resuspended in 1 mL 1M sorbitol and 8 mL of YE with 30% glucose, before incubation for at least 16 hours at 30°C with shaking and plating onto selective agar medium. ..

    other:

    Article Title: Stringent selection drives convergence toward omicron-like SARS-CoV-2 receptor-binding motifs.
    Article Snippet: Site-directed mutagenesis to introduce the I358F mutation was performed on the WT RBD using restriction-free cloning by PCR and primer I358F (CCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGATTTAGCAACTGTGTTGCTG ATTATTCTG) similarly to incorporation of genes 81.



    Similar Products

    96
    Bio-Rad micropulser electroporator
    Micropulser Electroporator, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/micropulser+electroporator/MicroPulser+Electroporator/pmc13058971-162-3-5
    Average 96 stars, based on 1 article reviews
    micropulser electroporator - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Bio-Rad electroporation cuvettes
    Schematic illustration of the preparation of M2-exo@HI and its mediated therapeutic mechanisms and signaling pathways. (a) RAW264.7 macrophages were polarized to M2 phenotype using DEX, followed by M2-exo isolation from cell supernatant via differential centrifugation. M2-exo@HI was prepared through encapsulating HI into M2-exo by <t>electroporation.</t> (b) M2-exo@HI crossed the BBB and localized to microglia in the hemorrhagic brain, delivering the HI plasmid into the nucleus. This prompted expression and secretion of Hp and IL-10 by microglia. The released Hp inhibited Hb toxicity by binding to Hb. IL-10 shifted microglial polarization from the pro-inflammatory M1 phenotype toward the reparative M2 phenotype, removing hematoma by engulfing erythrocyte and Hb-Hp complex, and decreasing pro-inflammatory cytokine levels—collectively enhancing neuroprotection and BBB repair. These beneficial outcomes were linked to the inhibition of the IL-17 and NF-κB signaling pathways and activation of the PI3K-Akt and ferroptosis pathways.
    Electroporation Cuvettes, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/micropulser+electroporator/Gene+Pulser+%2FMicroPulser+Electroporation+Cuvettes/pmc12887785-63-21-23
    Average 96 stars, based on 1 article reviews
    electroporation cuvettes - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Bio-Rad micropulsertm
    Schematic illustration of the preparation of M2-exo@HI and its mediated therapeutic mechanisms and signaling pathways. (a) RAW264.7 macrophages were polarized to M2 phenotype using DEX, followed by M2-exo isolation from cell supernatant via differential centrifugation. M2-exo@HI was prepared through encapsulating HI into M2-exo by <t>electroporation.</t> (b) M2-exo@HI crossed the BBB and localized to microglia in the hemorrhagic brain, delivering the HI plasmid into the nucleus. This prompted expression and secretion of Hp and IL-10 by microglia. The released Hp inhibited Hb toxicity by binding to Hb. IL-10 shifted microglial polarization from the pro-inflammatory M1 phenotype toward the reparative M2 phenotype, removing hematoma by engulfing erythrocyte and Hb-Hp complex, and decreasing pro-inflammatory cytokine levels—collectively enhancing neuroprotection and BBB repair. These beneficial outcomes were linked to the inhibition of the IL-17 and NF-κB signaling pathways and activation of the PI3K-Akt and ferroptosis pathways.
    Micropulsertm, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/micropulser+electroporator/MicroPulser+Electroporator/pmc13138187-104-0-2
    Average 96 stars, based on 1 article reviews
    micropulsertm - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Bio-Rad cuvette
    Schematic illustration of the preparation of M2-exo@HI and its mediated therapeutic mechanisms and signaling pathways. (a) RAW264.7 macrophages were polarized to M2 phenotype using DEX, followed by M2-exo isolation from cell supernatant via differential centrifugation. M2-exo@HI was prepared through encapsulating HI into M2-exo by <t>electroporation.</t> (b) M2-exo@HI crossed the BBB and localized to microglia in the hemorrhagic brain, delivering the HI plasmid into the nucleus. This prompted expression and secretion of Hp and IL-10 by microglia. The released Hp inhibited Hb toxicity by binding to Hb. IL-10 shifted microglial polarization from the pro-inflammatory M1 phenotype toward the reparative M2 phenotype, removing hematoma by engulfing erythrocyte and Hb-Hp complex, and decreasing pro-inflammatory cytokine levels—collectively enhancing neuroprotection and BBB repair. These beneficial outcomes were linked to the inhibition of the IL-17 and NF-κB signaling pathways and activation of the PI3K-Akt and ferroptosis pathways.
    Cuvette, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/micropulser+electroporator/Gene+Pulser+%2FMicroPulser+Electroporation+Cuvettes/bio_rxiv__64898__2026__05__06__722817-135-22-23
    Average 96 stars, based on 1 article reviews
    cuvette - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Bio-Rad gap electroporation cuvette
    Schematic illustration of the preparation of M2-exo@HI and its mediated therapeutic mechanisms and signaling pathways. (a) RAW264.7 macrophages were polarized to M2 phenotype using DEX, followed by M2-exo isolation from cell supernatant via differential centrifugation. M2-exo@HI was prepared through encapsulating HI into M2-exo by <t>electroporation.</t> (b) M2-exo@HI crossed the BBB and localized to microglia in the hemorrhagic brain, delivering the HI plasmid into the nucleus. This prompted expression and secretion of Hp and IL-10 by microglia. The released Hp inhibited Hb toxicity by binding to Hb. IL-10 shifted microglial polarization from the pro-inflammatory M1 phenotype toward the reparative M2 phenotype, removing hematoma by engulfing erythrocyte and Hb-Hp complex, and decreasing pro-inflammatory cytokine levels—collectively enhancing neuroprotection and BBB repair. These beneficial outcomes were linked to the inhibition of the IL-17 and NF-κB signaling pathways and activation of the PI3K-Akt and ferroptosis pathways.
    Gap Electroporation Cuvette, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/micropulser+electroporator/Gene+Pulser+%2FMicroPulser+Electroporation+Cuvettes/bio_rxiv__64898__2026__05__06__723379-276-25-28
    Average 96 stars, based on 1 article reviews
    gap electroporation cuvette - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Bio-Rad gene pulser micropulser electroporation cuvettes
    Schematic illustration of the preparation of M2-exo@HI and its mediated therapeutic mechanisms and signaling pathways. (a) RAW264.7 macrophages were polarized to M2 phenotype using DEX, followed by M2-exo isolation from cell supernatant via differential centrifugation. M2-exo@HI was prepared through encapsulating HI into M2-exo by <t>electroporation.</t> (b) M2-exo@HI crossed the BBB and localized to microglia in the hemorrhagic brain, delivering the HI plasmid into the nucleus. This prompted expression and secretion of Hp and IL-10 by microglia. The released Hp inhibited Hb toxicity by binding to Hb. IL-10 shifted microglial polarization from the pro-inflammatory M1 phenotype toward the reparative M2 phenotype, removing hematoma by engulfing erythrocyte and Hb-Hp complex, and decreasing pro-inflammatory cytokine levels—collectively enhancing neuroprotection and BBB repair. These beneficial outcomes were linked to the inhibition of the IL-17 and NF-κB signaling pathways and activation of the PI3K-Akt and ferroptosis pathways.
    Gene Pulser Micropulser Electroporation Cuvettes, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/micropulser+electroporator/Gene+Pulser+%2FMicroPulser+Electroporation+Cuvettes/pm42103732-235-23-27
    Average 96 stars, based on 1 article reviews
    gene pulser micropulser electroporation cuvettes - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Bio-Rad micropulser
    Schematic illustration of the preparation of M2-exo@HI and its mediated therapeutic mechanisms and signaling pathways. (a) RAW264.7 macrophages were polarized to M2 phenotype using DEX, followed by M2-exo isolation from cell supernatant via differential centrifugation. M2-exo@HI was prepared through encapsulating HI into M2-exo by <t>electroporation.</t> (b) M2-exo@HI crossed the BBB and localized to microglia in the hemorrhagic brain, delivering the HI plasmid into the nucleus. This prompted expression and secretion of Hp and IL-10 by microglia. The released Hp inhibited Hb toxicity by binding to Hb. IL-10 shifted microglial polarization from the pro-inflammatory M1 phenotype toward the reparative M2 phenotype, removing hematoma by engulfing erythrocyte and Hb-Hp complex, and decreasing pro-inflammatory cytokine levels—collectively enhancing neuroprotection and BBB repair. These beneficial outcomes were linked to the inhibition of the IL-17 and NF-κB signaling pathways and activation of the PI3K-Akt and ferroptosis pathways.
    Micropulser, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/micropulser+electroporator/MicroPulser+Electroporator/bio_rxiv__64898__2026__05__03__722528-149-11-12
    Average 96 stars, based on 1 article reviews
    micropulser - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Bio-Rad cm gap cuvette
    Schematic illustration of the preparation of M2-exo@HI and its mediated therapeutic mechanisms and signaling pathways. (a) RAW264.7 macrophages were polarized to M2 phenotype using DEX, followed by M2-exo isolation from cell supernatant via differential centrifugation. M2-exo@HI was prepared through encapsulating HI into M2-exo by <t>electroporation.</t> (b) M2-exo@HI crossed the BBB and localized to microglia in the hemorrhagic brain, delivering the HI plasmid into the nucleus. This prompted expression and secretion of Hp and IL-10 by microglia. The released Hp inhibited Hb toxicity by binding to Hb. IL-10 shifted microglial polarization from the pro-inflammatory M1 phenotype toward the reparative M2 phenotype, removing hematoma by engulfing erythrocyte and Hb-Hp complex, and decreasing pro-inflammatory cytokine levels—collectively enhancing neuroprotection and BBB repair. These beneficial outcomes were linked to the inhibition of the IL-17 and NF-κB signaling pathways and activation of the PI3K-Akt and ferroptosis pathways.
    Cm Gap Cuvette, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/micropulser+electroporator/Gene+Pulser+%2FMicroPulser+Electroporation+Cuvettes/pmc12856188-62-8-10
    Average 96 stars, based on 1 article reviews
    cm gap cuvette - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results


    Schematic illustration of the preparation of M2-exo@HI and its mediated therapeutic mechanisms and signaling pathways. (a) RAW264.7 macrophages were polarized to M2 phenotype using DEX, followed by M2-exo isolation from cell supernatant via differential centrifugation. M2-exo@HI was prepared through encapsulating HI into M2-exo by electroporation. (b) M2-exo@HI crossed the BBB and localized to microglia in the hemorrhagic brain, delivering the HI plasmid into the nucleus. This prompted expression and secretion of Hp and IL-10 by microglia. The released Hp inhibited Hb toxicity by binding to Hb. IL-10 shifted microglial polarization from the pro-inflammatory M1 phenotype toward the reparative M2 phenotype, removing hematoma by engulfing erythrocyte and Hb-Hp complex, and decreasing pro-inflammatory cytokine levels—collectively enhancing neuroprotection and BBB repair. These beneficial outcomes were linked to the inhibition of the IL-17 and NF-κB signaling pathways and activation of the PI3K-Akt and ferroptosis pathways.

    Journal: Bioactive Materials

    Article Title: M2 macrophage-derived exosomes delivering haptoglobin and interleukin-10 plasmids for synergistic therapy of intracerebral hemorrhage

    doi: 10.1016/j.bioactmat.2026.01.047

    Figure Lengend Snippet: Schematic illustration of the preparation of M2-exo@HI and its mediated therapeutic mechanisms and signaling pathways. (a) RAW264.7 macrophages were polarized to M2 phenotype using DEX, followed by M2-exo isolation from cell supernatant via differential centrifugation. M2-exo@HI was prepared through encapsulating HI into M2-exo by electroporation. (b) M2-exo@HI crossed the BBB and localized to microglia in the hemorrhagic brain, delivering the HI plasmid into the nucleus. This prompted expression and secretion of Hp and IL-10 by microglia. The released Hp inhibited Hb toxicity by binding to Hb. IL-10 shifted microglial polarization from the pro-inflammatory M1 phenotype toward the reparative M2 phenotype, removing hematoma by engulfing erythrocyte and Hb-Hp complex, and decreasing pro-inflammatory cytokine levels—collectively enhancing neuroprotection and BBB repair. These beneficial outcomes were linked to the inhibition of the IL-17 and NF-κB signaling pathways and activation of the PI3K-Akt and ferroptosis pathways.

    Article Snippet: M2-exo (100 μL, 1 mg/mL), HI plasmid (circular pBudCE4.1, 100 μg, TsingkeBiotechnology., Ltd.), and 100 μL PBS were added to the electroporation cuvettes (Bio-Rad 165-2088).

    Techniques: Protein-Protein interactions, Isolation, Centrifugation, Electroporation, Plasmid Preparation, Expressing, Binding Assay, Inhibition, Activation Assay