micropulser electroporator (Bio-Rad)
Structured Review
Micropulser Electroporator, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1635 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/micropulser+electroporator/MicroPulser+Electroporator/pmc13058971-162-3-5
Average 96 stars, based on 1635 article reviews
Images
Related Articles
Electroporation:Article Title: Protocol to identify SINE-VNTR-Alu regulators using genome-wide screening in human K562 cells Article Snippet: .. Conduct electroporation in Article Title: CRISPR-Cas effector polypeptides and methods of use thereof Article Snippet: .. The Casλ vectors and Casλ vectors with a non-targeting guide control plasmid were transformed into 25 μL of electrocompetent cells with 100 ng of plasmid via electroporation in 0.1 mm electroporation cuvettes (Bio-Rad) on a Article Title: Electrode Reduction by Vibrio natriegens Depends on Balanced Expression of Multiheme Cytochromes Article Snippet: For transformation by electroporation, 100 ng of plasmid DNA was mixed with a 50 μL aliquot of electrocompetent V. natriegens cells in a 1 mm gap electroporation cuvette (Bio-Rad, 1652089). .. Electroporation was performed at 0.9 kV using a Control:Article Title: CRISPR-Cas effector polypeptides and methods of use thereof Article Snippet: .. The Casλ vectors and Casλ vectors with a non-targeting guide control plasmid were transformed into 25 μL of electrocompetent cells with 100 ng of plasmid via electroporation in 0.1 mm electroporation cuvettes (Bio-Rad) on a Plasmid Preparation:Article Title: CRISPR-Cas effector polypeptides and methods of use thereof Article Snippet: .. The Casλ vectors and Casλ vectors with a non-targeting guide control plasmid were transformed into 25 μL of electrocompetent cells with 100 ng of plasmid via electroporation in 0.1 mm electroporation cuvettes (Bio-Rad) on a Article Title: Methods for evaluating bacterial dispersal on hyphal networks Article Snippet: .. Fifty microliter aliquots of the cell suspension were electroporated with five μL of pBBR-RFP plasmid using a Transformation Assay:Article Title: CRISPR-Cas effector polypeptides and methods of use thereof Article Snippet: .. The Casλ vectors and Casλ vectors with a non-targeting guide control plasmid were transformed into 25 μL of electrocompetent cells with 100 ng of plasmid via electroporation in 0.1 mm electroporation cuvettes (Bio-Rad) on a Article Title: Template Switching as a Driver of Promoter Evolution in Yeast: Case Study of the GRE2 Gene. Article Snippet: .. The ligated products were then transformed into NEB10-beta Electrocompetent cells using Biorad’s Suspension:Article Title: Methods for evaluating bacterial dispersal on hyphal networks Article Snippet: .. Fifty microliter aliquots of the cell suspension were electroporated with five μL of pBBR-RFP plasmid using a Incubation:Article Title: Evolutionary diversification of invertase paralogs couples carbon metabolism and sexual reproduction in fission yeasts Article Snippet: .. After incubation on ice for 5 mins, the mixture was electroporated using a other:Article Title: Stringent selection drives convergence toward omicron-like SARS-CoV-2 receptor-binding motifs. Article Snippet: Site-directed mutagenesis to introduce the I358F mutation was performed on the WT RBD using restriction-free cloning by PCR and primer I358F (CCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGATTTAGCAACTGTGTTGCTG ATTATTCTG) similarly to incorporation of genes 81. |
